CTx-648 – Cc 5013 Chemical

HDAC inhibition prevents hypobaric hypoxia‐induced spatial memory impairment through PΙ3K/GSK3β/CREB pathway

Abstract

Hypobaric hypoxia at higher altitudes usually impairs cognitive function. Previous studies suggested that epigenetic modifications are the culprits for this condition. Here, we set out to determine how hypobaric hypoxia mediates epigenetic mod- ifications and how this condition worsens neurodegeneration and memory loss in rats. In the current study, different duration of hypobaric hypoxia exposure showed a discrete pattern of histone acetyltransferases and histone deacetylases (HDACs) gene expression in the hippocampus when compared with control rat brains. The level of acetylation sites in histone H2A, H3 and H4 was significantly decreased under hypobaric hypoxia exposure compared to the control rat’s hippocampus. Additionally, inhibiting the HDAC family with sodium butyrate administration (1.2 g/kg body weight) attenuated neurodegeneration and memory loss in hypobaric hypoxia‐exposed rats. Moreover, histone acetylation increased at the promoter regions of brain‐derived neurotrophic factor (BDNF); thereby its protein expression was enhanced significantly in hypobaric hypoxia exposed rats treated with HDAC inhibitor compared with hypoxic rats. Thus, BDNF expression upregulated cAMP‐response element binding protein (CREB) phosphorylation by stimulation of PI3K/GSK3β/CREB axis, which counteracts hypobaric hypoxia‐ induced spatial memory impairment. In conclusion, these results suggested that sodium butyrate is a novel therapeutic agent for the treatment of spatial memory loss associated with hypobaric hypoxia, and also further studies are warranted to explore specific HDAC inhibitors in this condition.

KEYWOR DS
brain‐derived neurotrophic factor, histone acetyl transferases, histone deacetylase, hypobaric hypoxia

1 | INTRODUCTION

Hypobaric hypoxia (HH) at higher altitudes has been reported to cause cognitive dysfunction, especially learning and memory im- pairment. Altered neurotransmitter synthesis, uptake and release of free radical generation, changes in gene expressions and protein function are characteristically associated with hypoxia and ischaemia. In spite of several studies, the genome‐dependent me- chanisms for the neuronal response against hypoxia‐induced altera- tions in the brain are not very clear. Different hypoxic conditions were associated with a change in gene transcription (Perez‐Perri et al., 2011; Schweizer et al., 2013), but the mechanisms behind this change were not clearly understood. Clinical and preclinical studies suggested that HH exposure precipitates neurodegeneration in various regions of the brain (Beer et al., 2017; Maiti et al., 2008). Out of all brain regions studied, the hippocampus was found to be more vulnerable during HH stress‐induced damage and was closely associated with memory impairment loss (Jain et al., 2013).
Several studies have been published on the epigenetic mod- ifications in the regulation of neuronal response by regulating the expression of genes in the various pathophysiological influences of the environment‐like hypoxia and ischaemic conditions (Kong et al., 2018; Stanzione et al., 2020). Histone acetylation is one of the most studied epigenetic modifications that is maintained by histone acetyltransferase (HAT) and histone deacetylase (HDAC) and plays an imperative role in the regulation of gene expression. HAT cata- lysed the addition of methyl group at the lysine position of histone as well as nonhistone protein and deacetylase catalysed the removal of the methyl group from the lysine (Saha & Pahan, 2006; Tapias & Wang, 2017). Moreover, histone acetylation was associated with transcriptional activation, whereas deacetylation leads to transcrip- tional inactivation under different environmental conditions, which may influence cognitive functions. Similarly, hypoxia increases the expression of hypoxia‐inducible factor 1 (HIF1), which is the result of the interaction between HIF1 and acetyl transferases, such as p300, CREB binding protein (CBP), PCAF, SRC‐3 and deacetylase, which indicate the importance of the histone acetylation for adaptation against pre‐ and post‐hypoxia exposure (Dengler et al., 2014). Ad- ditionally, the interaction between CREB and CBP plays an important role in the regulation of long‐term memory (Chen et al., 2012). It has been reported that during contextual fear memory formation, the level of histone acetylation increased at the promoter of CREB whereas decreased level of deacetylation leads to the consolidation of fear memory (Yildirim et al., 2014). Additionally, brain‐derived neurotrophic factor (BDNF) plays a vital role in synaptic plasticity and maintenance of long‐term memory. Extinction of conditioned fear is accompanied by a significant increase in histone H4 acetylation at the promoter of BDNF in hippocampus after latent inhibition of conditioned fear (Tsankova et al., 2004). In the ageing mice model, the level of H4 acetylation at lysine 12 (H4K12ac) dysregulated and downregulated the expression of genes in the hippocampus involved in learning and memory. Renewal of the H4K12ac expression re- stored the expression of learning‐induced genes and recovered the cognitive function (Peleg et al., 2010).
Additionally, HDACs play an important role in learning and memory, synaptic plasticity, adult neurogenesis (Li et al., 2016; Sun et al., 2011), psychiatric and neurologic diseases (Qiu et al., 2017). The mammalian genome is composed of 18 HDAC enzymes, which are generally divided into four classes: I, II, III and IV (Yang & Seto, 2008). HDACs are known to play a pivotal role in brain functions, as inhibiting HDACs showed a neuroprotective effect in neurological disorders like traumatic brain in- jury, Alzheimer’s disease, Huntington disease and so forth. Accumulating literature also evidenced enhancement in cognitive function in rats after HDACs’ inhibition (Choi et al., 2017). In spite of recent advancements made in exploring the epigenetic changes, especially histone acetylation during different neurological disorders utilizing HDAC inhibitors, its role in stress‐like HH conditions is still an enigma.
Several studies articulated the epigenetic modifications in the regulation of gene expression under different neurological condi- tions, but little is known about epigenetic modification in the brain under hypoxia state. Therefore, the present study is aimed to profile the changes in histone acetylation during different durations of HH state within the hippocampus, a brain region implicated in learning and memory. Moreover, therapeutic potentials of HDAC inhibition against HH‐induced damage at the behavioural and cellular levels were also evaluated.

2 | MATERIALS AND METHODS

2.1 | Animals

Sprague Dawley (SD) adult male rats (250–300 g) were obtained from the National Institute of Nutrition (NIN)‐Hyderabad, India. These animals were maintained under pathogen‐free conditions on the rice husk bedding in polypropylene cages. Rats were fed with a standard rodent pellet and water ad libitum in the institute’s animal facility. The temperature and humidity of animal houses were maintained at 25±1°C and 55 ± 10%, respectively, with 12‐h 108 light–dark cycle. Rats used for the present study were approved by the animal ethical committee (IAEC/DIPAS/2015‐16/Extn) of the institute in accordance with the guidelines of “Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA),” Government of India. All experiments were conducted in accordance with the international standard on animal welfare as well as in compliance with national and local regulations. The total number of rats used in the present study in respective groups is summarized in Table 1.

2.2 | Hypobaric hypoxia exposure

Rats were exposed to hypobaric hypoxia (HH) at 7600 m (i.e., 25000 ft) in an animal decompression chamber for continuous ex- posure of 1, 3, 7 and 14 days, respectively, with a 15‐min interval each day for food, water and cage husk replenishment. A continuous supply of fresh air was provided at a rate of 8 L/min to prevent the accumulation of carbon dioxide. The temperature and humidity of the decompression chamber were maintained at 24 ± 2°C and 55 ± 5%, respectively. The rate of ascents and descents were main- tained at 300 m/min for exposure.

2.3 | Experimental design

The schematic representation of the experimental design of the present study is represented in Figure 1. Briefly, animals were ma- jorly divided into two groups as Control (unexposed) and HH‐ exposed rats. HH exposed group rats were further categorized into 1‐day HH (1DHH), 3‐day HH (3DHH), 7‐day HH (7DHH) and 14‐day exposure. Additionally, we have also used western blot (WB) analysis for the quantification of site‐specific histone acetylation of H2b, H3 and H4 in the hippocampus. Furthermore, we have also studied the role of HDAC inhibitor, sodium butyrate (SB) (Sigma; cat no. B5887‐ 1G, Lot #SLBL2659V, RRID: Not registered) in neurodegeneration and spatial memory impairment. SB was administered daily with a dose of 1.2 gm/kg body weight through the intraperitoneal (i.p.) route, as reported previously (Yamawaki et al., 2012), for a period of 14 days to HH exposure as well as control rats. So, the animals were divided in four groups: Group I as control + saline, Group II as 14DHH+ saline, group III as control + SB and Group IV as 14DHH + SB. After completion of HH exposure, spatial memory impairment, neuronal morphology alteration, neurodegeneration, site‐ specific histone acetylation and regulation of BDNF expression through histone acetylation were studied. The time points of the present study design are represented in Figure 1.

2.4 | Sample collections

After completion of HH exposure, rats were sacrificed by CO2 as- phyxiation and whole brain was immediately removed, followed by isolated the hippocampus. Hippocampus was immediately snap‐ frozen in liquid nitrogen and stored at −80°C until further use. These snap‐freezed samples were further used for protein and gene ex- pression studies.

2.5 | Nuclear extraction

Nuclear extraction from the hippocampus was performed using a Nuclear/Cytosol Fractionation Kit (Bio Vision; #K266‐25). Initially, hippocampus tissue was cut into small pieces by a blade. 2 ml cold 0.1 M phosphate‐buffered saline (PBS) was added and homogenized, followed by centrifugation at 500g for 3 min. The supernatant was discarded and the pellet was dissolved in 0.2 ml cytosol extraction buffer A (CEB‐A) mix and vortexed vigorously, followed by 10‐min incubation on ice. After incubation, 11 µl cytosol extraction buffer B (CEB‐B) was added and again vortexed vigorously, followed by 1‐min incubation on ice. The sample was again vortexed and then centrifuged at 16,000g. Immediately, supernatant (cytoplasmic ex- tract) was transferred to other microtubes for further use, and the pellet was dissolved in 100 µl ice‐cold nuclear extraction buffer supplied with the kit. Microtube was vortexed at high speed and then kept on ice. This step was repeated 10 times and then centrifuged at 16,000g for 10 min and supernatant (containing nuclear extract) collected in a chilled microtube. This nuclear extract was stored at −80°C for further use.

2.6 | HAT activity assay

The activity of HAT was quantified using HAT activity colorimetric assay Kit (Bio Vision; #K332‐100), and the procedure was followed as per the instruction manual of the kit. Briefly, the assay was per- formed in U‐shaped 96‐well plate using 50 µl nuclear extract (final volume 40 µl), 40 µl water as blank and HeLa cell nuclear extract as a positive control. Further, 68 µl assay mixture (contains 50 µl 2X HAT assay buffer, 5 µl HAT subtract I, 5 µl HAT subtract II and 8 µl NADH‐generating enzyme) was added in each well, followed by incubation at 37°C for 3 h and 45 min. After completion of incubation, absorbance was recorded at 440 nm using a spectrophotometer.

2.7 | HDAC activity assay

The activity of histone deacetyl transferases was performed using HDAC Assay Kit (Millipore; colorimetric detection; #17‐374) and the assay was performed as per the instruction manual of the kit. In brief, 10 µl of 2X HDAC assay buffer was added in 96‐well plate, followed by 20 µl of histone extract or 20 µl Hela nuclear extract (as positive control) or 20 µl water (as negative control) were added and in- cubated at 37°C. After incubation, 10 µl of 4 mM HDAC substrate was added and thoroughly mixed, followed by incubation of micro- titer plate at 37°C for 60 min. After incubation, 20 µl diluted acti- vator solution was added to each well and incubated at room temperature for 20 min. Absorbance was read at 405 nm using a spectrophotometer.

2.8 | Quantitative PCR

Total RNA was isolated from rat hippocampus using Qiagen RNA isolation kit (RNesay Mini Kit; Qiagen; #74104; Lot #154044552) and quantified through Nano Drop spectrometer by 260/280 ratio. After quantification, 5 µg of RNA from each experimental group was utilized for cDNA synthesis using a cDNA synthesis assay kit (Thermo Fisher Scientific; #AB‐1453/A). This cDNA (1 µl) was further used as a DNA template in real‐time PCR for quantification of targeted gene expression using forward and reverse primers of the respective genes. The list of forward and reverse primers is given in Table 2 and the endogenous control glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) was used to normalize the quantification of the targeted mRNA (Kidambi et al., 2010). The relative quantification (RQ) or fold changes of gene expression under HH exposed rats compared with control rats were analysed using the 2‐ΔΔCt method (Livak & Schmittgen, 2001).

2.9 | Immunoblotting

2.9.1 | Histone extraction

Histone extraction from hippocampus was performed using a histone extraction kit (Abcam; #ab113476). Tissues were chopped into small pieces and lysed using pre‐lysis buffer supplied with the kit, followed by homogenization in a tube using dounce homogenizer. Homo- genate was transferred in a new 2 ml vial, followed by centrifugation at 10,000 rpm for 1 min at 4°C. The supernatant was removed and tissue pellet was further resuspended in lysis buffer and then in- cubated for 30 min on ice. After incubation, the pellet was lysed and centrifuged at 12,000 rpm for 5 min at 4°C. Supernatant fraction (composed of acid‐soluble proteins) was transferred into a new vial and Dithiothreitol buffer was added. Protein 207 samples were stored at −20°C for further experimentation.

2.9.2 | Immunoblotting

The level of histone acetylation was performed through im- munoblotting using histone extract (Rumbaugh & Miller, 2011). The extracted histone protein (5 µg) was mixed with sample buffer (composition: 6.25 mM Tris, pH 6.8, 2% sodium dodecyl sulfate [SDS], 10% glycerol, 1.25% 2‐mercaptoethanol, 0.1% bromophenol blue) and seprated on SDS‐PAGE gel electrophoresis. After separation of proteins, it was transferred on polyvinylidene difluoride (PVDF) membrane using semidry transblot (Bio‐Rad; #1620177) instrument. This PVDF membrane was preactivated with 100% methanol folowed by washing with transfer buffer (20% methanol, 0.3% Tris, 1.44% glycine). After transfer, the membrane was blocked in 3% bovine serum albumin (prepared in 1 ml Tween 20 in 1 lit of 1× PBS [0.1% PBST]) and incubated for 2 hours at room temperature (RT) on a rocker. Membrane was blocked in diluted primary antibodies H3K9 (1:1000; Abcam; #ab4441), H3K14 (1:1000; Abcam; 220 #ab52946), H4K5 (1:1500; Abcam; #ab51957) H4K8 (1:1000; Epigentek; #A‐ 4028), H4K12 (1:1000; Abcam; #ab46983) and H2BK5 (1:1000; Abcam; #ab40886) incubated overnight at 4°C. Additionally, the expression of glycogen synthase kinase 3β (GSK3β) (1:1500; Abcam; #ab131356), phospho‐GSK3β (1:1000; Abcam; #ab107166), phos- phoinositide 3‐kinase (PI3K) (1:1000; Abcam; #ab86714), phosphor‐ PI3K (1:1500; CST; #4228), BDNF (1:1000; #ab203573), CREB (1:1000; Abcam; #ab31387) and phosphor‐CREB (1:500; Abcam; #ab32096) were quantified using whole‐cell extract of hippocampus. After washing with 0.1% PBST, the membrane was incubated in horseradish peroxidase‐conjugated secondary antibody (anti‐rabbit IgG) (1:5000; Millipore; #ab132P) or anti‐mouse IgG (H + L) (1:5000; Millipore; #ab124P) antibody for 120 s on rocking shaker at room temperature. The binding of primary and secondary antibodies on PVDF membrane was detected using 3,3ʹ‐diaminobenzidine tetra- hydrochloride (DAB; Sigma; #232 D5637) (1 mg/ml DAB in 1 × PBS). Integrated densities of each band were estimated using ImageJ software (National Institutes of Health). The relative histone acet- ylation density of H2B, H3 and H4 was normalized by total H2B (1:20,000; Abcam; #ab1790), H3 (1:20,000; Abcam; #ab1791) and H4 (1:20,000; Abcam; #ab10158), respectively, to naive acetylation levels.

2.10 | Spatial memory assessment through Morris water maze (MWM)

MWM (Morris et al., 1982) was used to observe spatial reference memory impairment in rodents. Before HH exposure, animals were trained for 7 days continuously to recognize the hidden platform in the water, followed by a probe trial, and a memory test was performed on the 8th day. During the training session, some rats (12 rats), which did not actively perform in MWM training, were excluded and replaced by new rats. After HH exposure, a single task of memory test and probe trial was performed. The position of the rat was recorded by an overhead camera as well as the computer‐assisted tracking system (Columbus Instruments). Rats were divided into different groups as described above and trained for 7 days, followed by training, probe trial was performed on 8th day. Each training session was comprised of four trials and the platform posi- tion remained the same throughout the training session. During training, rats were allowed to locate the escape platform, which was submerged in water for 60 s. If rats were unable to locate the plat- form, they were gently guided and left on the platform for 10 s. The latency and path length to reach the platform were recorded, and the mean of latency and path length were calculated. Impairments in spatial reference memory was assessed using probe trial and mem- ory test. A probe trial was performed pre and post HH exposure. Probe trial task was designed to assess the consolidation and re- trieval of spatial reference memory. It was a single trial in which the platform was removed from its position and rats were freely allowed to swim for 60 s and the number of the crossing was evaluated over the position of platform and time spent in the targeted quadrant (Jain et al., 2013).

2.11 | Histological study

2.11.1 | Cresyl violet (CV) staining

CV staining (Sigma; #c5042) was performed according to Jain et al. (2013) with some minor modifications. Briefly, 10‐μm‐thick cryosec- tions on gelatine precoated slide were taken and dried followed bywashing with 0.1 M PBS. Then, these sections were washed with dis- tilled water for 5 min, followed by staining with CV for 20 min. Sections became dark purple and the excess stain was removed by dipping the slide twice in distilled water. Sections were dehydrated with serial‐graded ethanol (50%, 70% and 100%) for 2 min each. Further, the sections were washed in xylene for 5 min to remove excess ethanol and fat. Sections were dried and mounted on the slide using dibutylphthalate polystyrene xylene (DPX; Sigma‐Merck; #AL2AF62758). Sections were observed under a bright‐field microscope and tangle‐shaped neurons were counted in the CA1 region of the hippocampus.

2.11.2 | Fluoro‐Jade C (FJ‐C) staining

Neurodegenerative neurons were studied using FJ‐C (Millipore; #AG325) stain, a polyanionic fluorescence derivative, which specifically binds to the apoptotic neurons. The FJ‐C method was modified from Schmid et al. (1997). Briefly, 30‐μm‐thick cryosections were washed with a solution containing 1% sodium hydroxide (NaOH) in 80% ethanol for 5 min incubation at room temperature. This was followed by 2 min washing with 70% ethanol and 2 min washing in distilled water. Then, sections were treated with 0.06% KMnO4 for 15 s on a the shaker and then washed with distilled water. Sections were stained with FJ‐C stain for 30 min on shaker and then washed three times with distilled water. After washing, excess water was removed and mounted on the slide using DPX medium. Images of FJ‐ C sections were captured using a fluorescence microscope (Olympus) and FJ‐C‐positive neurons were counted in the CA1 region of the hippocampus.

2.12 | Chromatin immunoprecipitation (ChIP) assay

ChIP was carried out according to the protocol previously suggested by Kumar and Thakur (2015) with some modificaton. Briefly, frozen hippocampal tissues were chopped into small fragments in 0.1 M PBS, followed by cross‐linking with 1% formaldehyde at 25°C for 15 min. These small fragments were homogenized in ChIP lysis buffer (5 mM pipes‐KOH, pH 8.0; 85 mM KCl and 0.5% NP‐40 with 1 mM protease inhibitors), followed by incubation at 4°C for 5 min and centrifuged at 1000g at 4°C for 5 min. The supernatant was dis- carded and the pellet was dissolved in ChIP nuclear lysis buffer (50 mM Tris–Cl, pH 8.0; 10 mM EDTA, pH 8.0; 1% sodium dodecyl sulphate with 1 mM protease inhibitors; Sigma‐Aldrich) and incubated at 4°C for 20 min. Pellet was dissolved in nuclear lysis buffer and sonicated for 15 s pulse on and 1‐min pulse off per cycle at 30% amplitude (AMPL) at 4°C (repeated seven cycles), followed by centrifugation at 12,000g at 4°C for 20 min. The supernatant containing chromatin fragments was stored for further use and the protein level was estimated by the Bradford method. The chromatin supernatant was further diluted in ChIP dilution buffer (100 mM NaCl; 20 mM Tris–Cl, pH 8.0; 2 mM EDTA, pH 8.0; 1% Triton X‐100, with 1 mM protease inhibitors) and incubated with Protein A‐sepharose beadslurry (20 µg) for 3 h at 4°C, followed by centrifugation at 4000g at 4°C for 10 min. After that, the chromatin supernatant was divided into input and immunoprecipitation fractions. Immunoprecipitation fraction was incubated overnight with anti‐H3K9/K14Ac (20 µg; H3K9Ac; Abcam; #ab4441), H3K14 (1:1000; Abcam; #ab52946), primary antibodies at 4°C. After completion of incubation, Protein A‐ sepharose bead slurry (50 µl) was added and incubated at 4°C for 2 h and centrifuged at 3500g for 10 min at 4°C. Pellets composed of immune complex were sequentially washed with low‐salt LiCl, high‐ salt LiCl, followed by TAE buffer. After washing, the immune complex was eluted by elution buffer (100 mM NaHCO3% and 1% SDS). The crosslinking between protein–DNA complexes was removed by adding 200 mM NaCl and incubated for 4 h at 65°C. After comple- tion of incubation, DNA was isolated by the phenol–chloroform method. The binding of this histone acetylation on BDNF was BDNF promoter specific sequence Forward 5’‐TCTCCCTGCCTC ATCCCT‐3′, Reverse 5’‐CAGAGTCTTCCTTTGCCTAC‐3′ (Zhu et al., 2014). RT‐PCR was performed with the following conditions: 95°C for 5 min, followed by 40 cycles at 94°C for 20 s, 56°C for 20 s and 72°C for 20 s. A standard curve was made by the use of absolute quantification of standard DNA for PCR products. The copy number of BDNF was normalized against GAPDH. Alteration in the level of histone acetylation at BDNF promoter was represented as relative fold change.

2.13 | Statistical analysis

The data of all experiments were represented as mean ± SEM and analysed through one‐way analysis of variance, followed by Bonfer- roni test using Graph Pad Prism software (Version 5.0). The prob- ability value of *p < .05 was considered statistically significant. 3 | RESULTS 3.1 | Effect of hypobaric hypoxia on global histone acetylation process The global histone acetylation process was studied by assessing the activity of two different enzymes that maintain the process of histone acetylation, that is, Histone acetyl HAT and HDAC in the hippo- campus. Results revealed that HH exposure for 1 and 3 days show insignificant changes in the activity of HATs and HDACs. However, HAT activity was significantly decreased on HH exposure for 7 days (**p < .01, Figure 2a) and 14 days (**p < .001, Figure 2a) compared with control rats. Interestingly, HDAC activity was found to increase on 7th day (**p < .01) and 14th day (***p < .001, Figure 2b) of HH exposure compared with control rats and no significant changes were observed on 1 and 3 days of HH exposure (Figure 2). 3.2 | Effect of hypobaric hypoxia exposure on HATs and HDACs mRNA expression The gene expression of various HATs and HDACs in the hippo- campus was studied at different time points of HH exposure using RT PCR. Results displayed the differential expressions of HATs and HDACs at different time points of HH exposure. The expression of HATs mRNA like Kat3a, Kat3b and Hat1 significantly increased (*p < .05, Table 3) up to 3 days of HH exposure compared with control rats. Differently, HH exposure to 7 and 14 days significantly decreased the Kat3a (*p < .05 and ***p < .001 respectively), Kat3b (**p < .01 and ***p < .001 respectively), Hat1 (*p < .05 and ***p < .001, respectively) and Qkf (***p < .001 on 14DHH) (Table 3) mRNA ex- pression when compared with control rats. However, no significant changes were found in the expressions of Kat, Ncao1 and Ncao2 at all durations of HH exposure (Table 3). Further, the expression of HDACs also showed a differential response at different durations of HH exposure. Indeed, 1 and 3 days of HH exposure showed insignificant changes in the mRNA expres- sion of class I and II HDACs, that is, HDAC1, HDAC2, HDAC3, HDAC8 and HDAC10, HDAC11, respectively (Table 3). Never- theless, HH exposure for 7 days significantly increased the mRNA expression of class I HDACs, that is, HDAC2 (*p < .05) and HDAC3 (**p < .01) as compared with control rats. Similarly, 14 days of HH exposure also significantly increased HDAC2 (***p < .001) and HDAC3 (**p < .01) mRNA expression when compared with control rats. However, the expression of Sirt family of HDAC was also in- significant on 1, 3, 7 and 14 days of HH exposure. The result showed that the expression of Sirt1 was significantly increased on 14‐day HH (*p < .05) exposure as compared with control rats. On the other hand, no significant changes were observed in the expression of Sirt 2,3,4,5,6 and 7 in different duration of HH exposure (Table 3). 3.3 | Hypobaric hypoxia exposure gradually decreased the residue‐specific histone acetylation in the hippocampus The expression of different residue‐specific histone acetylation markers was studied at the protein level using immunoblotting. Specifically, histone acetylation markers: H2BK5, H3K9, H3K14, H4K5, H4K8 and H4K12 associated with learning and memory were studied. Results revealed that the level of H2BK5ac significantly decreased on exposure to HH for 7 days (*p > .05, Figure 4b) and 14 days (**p > .01, Figure 4b) compared with control rats but this change was insignificant on 1 and 3 days of HH exposure. Further- more, H3K9ac level was downregulated on 3rd day (*p > .05, Figure 4c), 7th day (*p > .05, Figure 4c) and 14th day (**p > .001, Figure 4c) of HH exposure compared with the control group.
Similarly, H3K14 level significantly decreased (*p > .05, Figure 4d) on 14‐day HH exposure, but no significant change was observed on 1, 3 and 7 days of HH exposure when compared with control rats. Additionally, 14‐day HH exposure significantly decreased the level of H4K5ac (*p > .05, Figure 4f) compared with control rats. Further- more, the level of H4K8ac significantly decreased on 7th day (*p > .01, Figure 4g) and 14th day (*p > .05, Figure 4g) of HH exposure as compared with control rats. Additionally, the level of H4K12ac significantly decreased on 14th day (*p > .05, Figure 4h) of HH ex- posure compared with control rats. Also, there were no significant changes observed in the levels of H4K5ac, H4K8ac and H4K12ac on 1 and 3 days of HH exposure compared with control rats (Figure 4).

3.4 | HDAC inhibition prevents hypobaric hypoxia‐induced spatial memory impairment and neurodegeneration

HDAC was inhibited by using SB, an inhibitor of the HDAC1 and HDAC2 family. After completion of 14 days of HH exposure, spatial memory was tested using the MWM task. Results have displayed that 14 days of HH exposure impaired spatial memory as evident from significantly increased path length (***p < .01, Figure 5b) and latency (**p < .01, Figure 5c). Whereas decreased in the number of platform crossing (**p < .01, Figure 5e) and time spent (***p < .001, Figure 5f) in target quadrant was observed as compared with control group. While, HDAC inhibition ameliorated this effect by decreasing the path length (#p < .05, Figure 5b) and latency (##p < .01, Figure 5c) and increased in number of platform crossing (#p < .05, Figure 5e) and time spent in target quadrant (#p < .05, Figure 5f) compared with nontreated 14‐day HH rats. Previously, we have shown HH exposure for 14 days leads to neuronal morphology alteration and neurodegeneration in the CA1 region of the hippocampus. (Dheer et al., 2018; Kumar et al., 2018; Kushwah et al., 2018). To evaluate the effect of HDAC inhibition on neuronal morphology alteration and neurodegeneration, CV and Fluoro jade (FJ) staining were performed, respectively. As noted previously, the current study also observed a significantly increased (**p < .01 Figure 6e) number of pyknotic cells and FJ‐positive cells (***p < .001, Figure 6f) at 14 days of HH exposure compared with control rats in CA1 region of the hippocampus. On the other hand, HDAC inhibition significantly reduced the number of pyknotic cells (#p < .05, Figure 6e) and the number of FJ‐positive cells (###p < .001, Figure 6f) when compared with HH‐exposed rats (Figure 6). 3.5 | HDAC inhibition promotes acetylation at bdnf promoter region BDNF plays a pivotal role in learning and memory and neuronal survival in different neurological conditions. Results of the present study showed that 14 days of HH exposure significantly reduced the BDNF protein levels (**p < .01, Figure 7d) as well as mRNA levels (**p < .01, Figure 7e). The expression of BDNF was significantly ameliorated by HDAC inhibition in rats, which is evident from in- creased expression of BDNF at the protein level (##p < .01, Figure 7d) and mRNA level (#p < .05, Figure 7e) compared with HH‐exposed rats (Figure 7). Similarly, HH exposure decreased the level of histones H3K9 (**p < .01, Figure 7b) and H3K14 (#p < .05, Figure 7c) acetyla- tion in the hippocampus compared with control rats. However, in- hibition of HDAC increased the level of histone H3K9 (#p < .05, Figure 7b) and H3K14 (#p < .05, Figure 7c) compared with non-treated 14‐day HH‐exposed rats (Figure 7). To further explore the mechanism responsible for the reg- ulation of BDNF expression, we quantified the level of histone acetylation at the promoter region of BDNF. Results revealed that the level of H3K9Ac (**p < .01, Figure 7f) and H3K14Ac (*p < .05, Figure 7g) at the promoter region of BDNF were significantly lowered in HH‐exposed rats. Conversely, the levels of H3K9Ac at the promoter region of BDNF significantly increased (#p < .05) in HH‐exposed rats treated with HDACi, but no significant change was observed in H3K14Ac (Figure 7) expression at the promoter of BDNF. 3.6 | HDAC inhibition offered neuroprotection via activation of PI3K/GSK3β/CREB signalling pathway BDNF promotes neuronal survival under stress condition by activating different MAPK pathways, which regulates the survi- val machinery of the cell. Results of the present study showed that HH exposure significantly reduced the level of PI3K phosphorylation (*p < .05, Figure 8b) compared with control group rats. In contrast, the inhibition of HDAC under HH con- dition significantly enhanced (#p < .05, Figure 8b) the phosphorylation of PI3K protein when compared with HH‐exposed rats (Figure 8). Glycogen synthase kinase 3β (GSK‐3β) is known for its apop- totic effect and phosphorylation of GSK3 β leads to its deactiva- tion and reduces the process of apoptosis. In the present study, HH exposure decreased the level of GSK‐3β phosphorylation (**p < .01, Figure 8c) and simultaneous the administration of HDAC inhibitor during HH exposure to rats prevented this activation of GSK‐3β by increasing (##p < .01, Figure 8c) its phosphorylation (Figure 8). Moreover, the present study also witnessed that 14 days of HH exposure significantly decreased (**p < .01, Figure 8f) the phosphor- ylation of CREB when compared with control rats. However, HDAC inhibition reverted this effect by phosphorylation of CREB (#p < .05) to normal level (Figure 8). 4 | DISCUSSION Considering the present understanding of epigenetic modulation and pathophysiological basis of various diseases, histone acetylation is one such process, which regulates the brain functions and alterations that may lead to pathological effects like neurodegeneration and memory impairment in many neurological diseases (Sanchez‐Mut & Gräff, 2015; Ziemke‐Nalecz, Jaworska, Sypecka, & Zalewska, 2018). In the present study, for the first time, we made efforts to explore the effects of HH on the histone acetylation process and its role in cognition. This study delineated the role of HH exposure disturbing histone acetylation homoeostasis by dwindling the HAT activity and enhancing HDAC activity that further reduced the BDNF expression. However, HDAC inhibition increased BDNF expression by increasing the level of histone acetylation at the BDNF promoter region and BDNF further promoted neuronal survival in HH exposure via activating the PI3K/GSK3β/CREB pathway. Acetylation and deacetylation of any protein are governed by HATs and HDACs, which form a vital channel through which the neuronal gene expression is regulated. Moreover, HH exposure for different duration of time causes impaired HATs/HDACs activity in a differential way, which directs to imbalanced chromatin acetylation, resulting in impinging of neuronal function (Saha & Pahan, 2006). The disturbance in the HAT: HDAC balance because of increased levels of HDAC expression or the activity is nullified by the administration of HDAC inhibitors as reported in different neurodegenerative dis- eases (Saha & Pahan, 2006). In contrast to this, HAT: HDAC im- balance also precipitated neurodegeneration and memory impairment. Moreover, an increase in HAT expression or activity has been reported to provide neuroprotection in Huntington's disease (Lee et al., 2013). In line with these findings, we also observed im- paired HAT: HDAC balance, which was evident by decreased HAT and increased HDAC activity on HH exposure for 7 and 14 days. We observed that increased HDAC activity and decreased HAT activity developed neurodegeneration and cognitive impairment during HH for 7 and 14 days. Furthermore, we observed that HH exposure for different time duration leads to a different pattern of HATs‐ and HDACs‐related gene expression at the transcriptional level. The expression of Tip60 (a HAT gene) ameliorated the cognitive function of the neurode- generative brain through epigenetic modification (Panikker et al., 2018), but HDAC2 negatively regulated cognitive functions, includ- ing memory and synaptic plasticity (Drissi et al., 2019). In the current study, a large fold change was observed in 1 and 3 days of HH exposure, but this change was restricted at 7 and 14 days of time. Interestingly, 1 and 3 days HH exposure activated the immune sys- tem as a compensatory mechanism against HH by upregulation of HAT genes. Hat1 brought back the lost HAT: HDAC homoeostasis. Whereas, Hat1 expression decreased during 14 days of HH exposure and increased Hat expression was articulated to be responsible for the regulation of adult neurogenesis (Gouveia et al., 2016), brain‐ derived growth factor (BDNF) gene expression (Tian et al., 2010), synaptic plasticity (Barrett et al., 2011) and cognitive function (Lima Giacobbo et al., 2019). Similarly, Demyanenko & Uzdensky, 2019 reported that photothrombotic stroke (PTS) induced cerebral ischaemia in rats increased Hat1 expression in the initial stage but reduced later, which was completely dependent on the duration of HH. In the same way, the levels of KAT3a (CBP) and KAT3b (p300) increased on 3rd day of HH exposure but decreased with 14 days of HH exposure. Moreover, KAT3a and KAT3b have been implicated in diversified processes like cell cycle regulation, apoptosis, embryonic development, cellular differentiation and cancer (Kalkhoven, 2004). Indeed, whether KAT3a or KAT3b interacts with transcription factor that regulates these processes and the mechanism is not still well known. Many studies articulated p300 and CBP as central regulators of several pathways and biological processes. Recently, in vivo stu- dies suggested that p300 and CBP are particularly important for activating gene expression programs when multipotent cells are in- duced to differentiate into mature lineages and are normally found in the brain (Sheikh, 2014). The possible reasons behind the reduced expression of these genes during 14 days HH exposure may be the gradual increase in severity of stress and the inability of cells to cope up with this stress, which may account for reduced expression of these genes. The HDACs genes after a different duration of HH exposure followed a distinct pattern, with a decline in several HDACs ex- pression on the initial duration of HH exposure (for 1 and 3 days); probably it was upregulated on further exposure to HH (7 and 14 days). Elevation in the expressions of HDAC in newborn may be responsible for hypoxic‐ischaemic encephalopathy disorder (Koyuncuoglu et al., 2015). Additionally, HH exposure for 7 and 14 days significantly upregulated the expression of HDAC2 and HDAC3, which were known to catalyse the removal of acetyl moieties from H3K9 and that may mediate the global hypoacetylation of H3K9 following HH exposure. Similar results were also reported earlier by Dovey et al. (2010) in the ECS model. The H3K9ac mark is highly correlated with active promoters and enhancers as well as associated with transcriptionally active chromatin (Karmodiya et al., 2012). A global reduction of H3K9 acetylation marks within the hippocampus and points toward major changes that arise in the epigenetic landscape following HH exposure. Decreased expression of HDAC10 and HDAC11 during the initial day of HH exposure may be due to compensatory response against oxidative stress, as these genes were more related to behavioural response against any stress condition (Funato et al., 2011). In animal models, HDAC inhibition by either silencing or inhibiting by any pharmacological interventions is well‐characterized in preventing memory deficits and in depression‐like behaviours (Deussing & Jakovcevski, 2017). HDAC inhibitors (HDACi) have been shown to be neuroprotective in several mouse models of nervous system disability, including Huntington's disease (Naia et al., 2013), spinal muscular atrophy (Farrelly‐Rosch et al., 2017), amyotrophic lateral sclerosis (Liu et al., 2013), ischaemia (Ziemke‐Nalecz, Jaworska, Sypecka and Zalewska, 2018) and Parkinson's disease (Suo et al., 2015). We also explored the efficacy of HDACi, that is, sodium butyrate (SB) against 14 days HH exposure induced neu- rodegeneration and cognitive decline. It was observed that inhibition of HDAC showed a promising effect in preventing memory impair- ment in spatial reference memory tasks and neurodegeneration in the CA1 region of the hippocampus. These results coincide with the observations of Fischer et al. (2007), who showed that treatment with the HDACi SB maintained hippocampal histone acetylation status and reversed the neurodegeneration and cognitive deficit. On the basis of these observations, we speculate that HDACi might rescue the HH‐mediated downregulation of memory‐related gene expression and spatial memory impairment. To prove this, we studied the effect of HDACi on HH‐induced histone acetylation, BDNF changes at the level of histone acetylation in the promoter region of the BDNF gene. SB administration mitigated the effects of HDAC imbalance and increased the level of histone acetylation at the promoter region of memory‐related genes, including early stress genes, Glu1 and Arc, in electroconvulsive seizure‐induced rat's brain (Park et al., 2014). Additionally, HDACi also increased the level of histone acetylation (including H3K9Ac and H3K4Ac) (Karmodiya et al., 2012). These studies are in agreement with our findings as HDACi increased the level of histone acetylation in the promoter region of BDNF and prevented HH‐induced spatial memory impairment. A study by Sartor et al. (2019) reported that SB increased the level of histone acetylation that further enhanced BDNF expression and enhanced memory consolidation in mice, which is in line with our observations in the current study. Further to dissect the molecular mechanisms involved in HDACi‐mediated neuroprotection, expressions of different signalling mole- cules of the PI3K pathway were studied in the hippocampus regions of cognitive‐impaired rats (Figure 9). One of the main components of the PI3K pathway is its downstream signalling protein Akt, which facilitates cellular proliferation and survival. Akt is known to nega- tively regulate several proapoptotic molecules (Kim et al., 2001). On the other hand, GSK3β mediates apoptosis in response to different stimuli. Akt inhibits GSK3β by phosphorylating the kinase on serine residue 9 (Alao et al., 2006; Wang et al., 2010) (Figure 9). Results of the present study showed a drastic decrease in p‐PI3K activity, which is evident from its reduced phosphorylation state during 14 days of HH exposure. Apart from this, HDAC inhibition enhanced PI3K phosphorylation, which further inactivated GSK3β, as evident from increased phosphorylation at Ser9 residue after HDAC inhibition. Similar results were also observed in a study by Ziemke‐Nalecz, Jaworska, Sypecka and Zalewska (2018), which showed a similar pattern of changes in ischaemia model and observed that HDAC inhibitor administration increased the expression of GSK3β‐Ser‐9 and Ser473‐ Akt and thereby showed a neuroprotective effect (Ahn et al., 2017). GSK3β is a key regulator of transcription factors, such as acti- vator protein‐1, CREB, heat shock protein and CCAAT/enhancer‐ binding protein (Murray et al., 2012; Stephanou & Latchman, 2011). Out of these, CREB is the most important transcription factor in- volved in cell survival and cognitive functions. However, CREB is the downstream target of the PI3K pathway and it was found that 14‐day HH exposure reduced CREB phosphorylation and also its activity. Inhibition of HDAC also reversed this damage by enhancing the level of pCREB in the rat hippocampus, which may account for the neuroprotective effect of HDACi. This effect may be one reason for the neuroprotective effect of HDACi in the present study. From the present study observations, we conclude that 7–14 days of HH exposure impairs the histone acetylation process of the hippocampus by disturbing the HAT/HDAC balance. This imbalance may account for altered gene regulation that directly links to the neurogenic and behavioural impairment of rats. On the other hand, HDAC inhibition also provides neuroprotection against HH‐induced neuronal damage and memory impairment. HDAC inhibition facilitated the acetylation process at the BDNF promoter region and thereby in- creased its protein expression. Moreover, we also studied the role of pPI3K/GSK3β/CREB signalling, affecting nerve function at different time points of HH exposure. An overall result of our study signifies the importance of HDAC inhibitors in offering neuroprotection against HH‐ induced nerve damage and spatial memory impairment. REFERENCES Ahn, M., Kim, J., Park, C., Cho, J., Jee, Y., Jung, K., Moon, C., & Shin, T. (2017). Potential involvement of glycogen synthase kinase (GSK)‐3β in a rat model of multiple sclerosis: Evidenced by lithium treatment. Anatomy & Cell Biology, 50(1), 48–59. Alao, J. P., Stavropoulou, A. V., Lam, E. W., & Coombes, R. C. (2006). Role of glycogen synthase kinase 3 beta (GSK3beta) in mediating the cytotoxic effects of the histone deacetylase inhibitor trichostatin A (TSA) in MCF‐7 breast cancer cells. Molecular Cancer, 3(5), 40. Barrett, R. M., Malvaez, M., Kramar, E., Matheos, D. P., Arizona, A., Cabrera, S. M., Lynch, G., Greene, R. W., & Wood, M. A. (2011). Hippocampal focal knockout of CBP affects specific histone modifications, long‐term CTx-648 potentiation, and long‐term memory. Neuropsychopharmacology, 36(8), 1545–1556.
Beer, J. M. A., Shender, B. S., Chauvin, D., Dart, T. S., & Fischer, J. (2017). Cognitive deterioration in moderate and severe hypobaric hypoxia conditions. Aerospace Medicine and Human Performance, 88(7), 617–626. Chen, R., Xu, M., Hogg, R. T., Li, J., Little, B., Gerard, R. D., & Garcia, J. A. (2012). The acetylase/deacetylase couple CREB‐binding protein/sirtuin 1 controls hypoxia‐inducible factor 2 signaling. Journal of Biological Chemistry, 287(36), 30800–30811.
Choi, H., Kim, H. J., Kim, J., Kim, S., Yang, J., Lee, W., Park, Y., Hyeon, S. J., Lee, D. S., Ryu, H., Chung, J., & Mook‐Jung, I. (2017). Increased acetylation of peroxiredoxin1 by HDAC6 inhibition leads to recovery of Aβ‐induced impaired axonal transport. Molecular Neurodegeneration, 12(1), 23.
Demyanenko, S., & Uzdensky, A. (2019). Epigenetic alterations induced by photothrombotic stroke in the rat cerebral cortex: Deacetylation of histone h3, upregulation of histone deacetylases and histone acetyltransferases. International Journal of Molecular Sciences, 20(12), 2882.
Dengler, V. L., Galbraith, M., & Espinosa, J. M. (2014). Transcriptional regulation by hypoxia inducible factors. Critical Reviews in Biochemistry and Molecular Biology, 49(1), 1–15.
Deussing, J. M., & Jakovcevski, M. (2017). Histone modifications in major depressive disorder and related rodent models. Advances in Experimental Medicine and Biology, 978, 169–183.
Dheer, A., Jain, V., Kushwah, N., Kumar, R., Prasad, D., & Singh, S. B. (2018). Temporal and spatial changes in glial cells during chronic hypobaric hypoxia: Role in neurodegeneration. Neuroscience, 383, 235–246.
Dovey, O. M., Foster, C. T., & Cowley, S. M. (2010). Emphasizing the positive: A role for histone deacetylases in transcriptional activation. Cell Cycle, 9(14), 2700–2701.
Drissi, I., Deschamps, C., Fouquet, G., Alary, R., Peineau, S., Gosset, P., Sueur, H., Marcq, I., Debuysscher, V., Naassila, M., Vilpoux, C., & Pierrefiche, O. (2019). Memory and plasticity impairment after binge drinking in adolescent rat hippocampus: GluN2A/GluN2B NMDA receptor subunits imbalance through HDAC2. Addiction Biology, e12760.
Farrelly‐Rosch, A., Lau, C. L., Patil, N., Turner, B. J., & Shabanpoor, F. (2017). Combination of valproic acid and morpholino splice‐switching oligonucleotide produces improved outcomes in spinal muscular atrophy patient‐derived fibroblasts. Neurochemistry International, 108, 213–221.
Fischer, A., Sananbenesi, F., Wang, X., Dobbin, M., & Tsai, L. H. (2007). Recovery of learning and memory is associated with chromatin remodelling. Nature, 447(7141), 178–182.
Funato, H., Oda, S., Yokofujita, J., Igarashi, H., & Kuroda, M. (2011). Fasting and high‐fat diet alter histone deacetylase expression in the medial hypothalamus. PLOS One, 6(4), e18950.
Gouveia, A., Hsu, K., Niibori, Y., Seegobin, M., Cancino, G. I., He, L., Wondisford, F. E., Bennett, S., Lagace, D., Frankland, P. W., & Wang, J. (2016). The aPKC‐CBP pathway regulates adult hippocampal neurogenesis in an age‐dependent manner. Stem Cell Reports, 7(4), 719–734.
Jain, V., Baitharu, I., Prasad, D., & Ilavazhagan, G. (2013). Enriched environment prevents hypobaric hypoxia induced memory impairment and neurodegeneration: Role of BDNF/PI3K/GSK3β pathway coupled with CREB activation. PLOS One, 8(5), e62235.
Kalkhoven, E. (2004). CBP and p300: HATs for different occasions. BiochemPharmacol, 68(6), 1145–1155.
Karmodiya, K., Krebs, A. R., Oulad‐Abdelghani, M., Kimura, H., & Tora, L. (2012). H3K9 and H3K14 acetylation co‐occur at many gene regulatory elements, while H3K14ac marks a subset of inactive inducible promoters in mouse embryonic stem cells. BMC Genomics, 13, 424.
Kidambi, S., Yarmush, J., Berdichevsky, Y., Kamath, S., Fong, W., & Schianodicola, J. (2010). Propofol induces MAPK/ERK cascade dependent expression of cFos and Egr‐1 in rat hippocampal slices. BMC Research Notes, 3, 201.
Kim, A. H., Khursigara, G., Sun, X., Franke, T. F., & Chao, M. V. (2001). Akt phosphorylates and negatively regulates apoptosis signal‐regulating kinase 1. Molecular and Cellular Biology, 21(3), 893–901.
Kong, Q., Hao, Y., Li, X., Wang, X., Ji, B., & Wu, Y. (2018). HDAC4 in ischemic stroke: Mechanisms and therapeutic potential. Clinical Epigenetics, 10(1), 117.
Koyuncuoglu, T., Turkyilmaz, M., Goren, B., Cetinkaya, M., Cansev, M., & Alkan, T. (2015). Uridine protects against hypoxic‐ischemic brain injury by reducing histone deacetylase activity in neonatal rats. Restorative Neurology and Neurosciences, 33(5), 777–784.
Kumar, A., & Thakur, M. K. (2015). Epigenetic regulation of Presenilin 1 and 2 in the cerebral cortex of mice during development. Developmental Neurobiology, 75, 1165–1173.
Kumar, R., Jain, V., Kushwah, N., Dheer, A., Mishra, K. P., Prasad, D., & Singh, S. B. (2018). Role of DNA methylation in hypobaric hypoxia‐ induced neurodegeneration and spatial memory impairment. Annals of Neurosciences, 25(4), 191–200.
Kushwah, N., Jain, V., Dheer, A., Kumar, R., Prasad, D., & Khan, N. (2018). Hypobaric Hypoxia‐Induced Learning and Memory Impairment: Elucidating the Role of Small Conductance Ca (2+)‐Activated K (+) Channels. Neuroscience, 388, 418–429.
Lee, J., Hwang, Y. J., Kim, K. Y., Kowall, N. W., & Ryu, H. (2013). Epigenetic mechanisms of neurodegeneration in Huntington’s disease. Neurotherapeutics, 10(4), 664–676.
Li, X., Bao, X., & Wang, R. (2016). Neurogenesis‐based epigenetic therapeutics for Alzheimer’s disease (review). Molecular Medicine Reports, 14(2), 1043–1053.
Lima Giacobbo, B., Doorduin, J., Klein, H. C., Dierckx, R. A. J. O., Bromberg, E., & de Vries, E. F. J. (2019). Brain‐Derived Neurotrophic Factor in Brain Disorders: Focus on neuroinflammation. Mol Neurobiol, 56(5), 3295–3312.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real‐time quantitative PCR and the 2^‐ΔΔCT Method. Methods, 25, 402–408.
Maiti, P., Muthuraju, S., Ilavazhagan, G., & Singh, S. B. (2008). Hypobaric hypoxia induces dendritic plasticity in cortical and hippocampal pyramidal neurons in the rat brain. Behavioural Brain Research, 189(2), 233–243.
Morris, E. K., Hursh, D. E., Winston, A. S., Gelfand, D. M., Hartmann, D. P., Reese, H. W., & Baer, D. M. (1982). Behaviour analysis and developmental psychology. Human Development, 25(5), 340–364.
Murray, D. R., Mummidi, S., Valente, A. J., Yoshida, T., Somanna, N. K., Delafontaine, P., Dinarello, C. A., & Chandrasekar, B. (2012). β2 adrenergic activation induces the expression of IL‐18 binding protein, a potent inhibitor of isoproterenol‐induced cardiomyocyte hypertrophy in vitro and myocardial hypertrophy in vivo. Journal of Molecular and Cellular Cardiology, 52(1), 206–218. Naia, L., Cunha‐Oliveira, T., Rodrigues, J., Rosenstock, T. R., Oliveira, A.,
Ribeiro, M., Carmo, C., Oliveira‐Sousa, S. I., Duarte, A. I., Hayden, M. R., & Rego, A. C. (2013). Histone deacetylaseinhibitors protect against pyruvate dehydrogenase dysfunction in Huntington’s disease. Journal of Neuroscience, 37(10), 2776–2794.
Panikker, P., Xu, S. J., Zhang, H., Sarthi, J., Beaver, M., Sheth, A., Akhter, S., & Elefant, F. (2018). Restoring Tip60 HAT/HDAC2 balance in the neurodegenerative brain relieves epigenetic transcriptional repression and reinstates cognition. Journal of Neuroscience, 38(19), 4569–4583.
Park, D. H., Hong, S. J., Salinas, R. D., Liu, S. J., Sun, S. W., Sgualdino, J., Testa, G., Matzuk, M. M., Iwamori, N., & Lim, D. A. (2014). Activation of neuronal gene expression by the JMJD3 demethylase is required for postnatal and adult brain neurogenesis. Cell Reports, 8(5), 1290–1299.
Peleg, S., Sananbenesi, F., Zovoilis, A., Burkhardt, S., Bahari‐Javan, S., Agis‐ Balboa, R. C., Cota, P., Wittnam, J. L., Gogol‐Doering, A., Opitz, L., Salinas‐Riester, G., Dettenhofer, M., Kang, H., Farinelli, L., Chen, W., & Fischer, A. (2010). Altered histone acetylation is associated with age‐dependent memory impairment in mice. Science, 328(5979), 753–756.
Perez‐Perri, J. I., Acevedo, J. M., & Wappner, P. (2011). Epigenetics: New questions on the response to hypoxia. Int J Mol Sci, 12(7), 4705–4721.
Qiu, X., Xiao, X., Li, N., & Li, Y. (2017). Histone deacetylases inhibitors (HDACis) as novel therapeutic application in various clinical diseases. Progress in Neuro‐Psychopharmacology and Biological Psychiatry, 72, 60–72.
Rumbaugh, G., & Miller, C. A. (2011). Epigenetic changes in the brain: Measuring global histone modifications. Methods in Molecular Biology, 670, 263–274.
Saha, R. N., & Pahan, K. (2006). HATs and HDACs in neurodegeneration: A tale of disconcerted acetylation homeostasis. Cell Death and Differentiation, 13(4), 539–550.
Sanchez‐Mut, J. V., & Gräff, J. (2015). Epigenetic alterations in Alzheimer’s disease. Frontiers in Behavioral Neuroscience, 17(9), 347. Sartor, G. C., Malvezzi, A. M., Kumar, A., Andrade, N. S., Wiedner, H. J.,
Vilca, S. J., Janczura, K. J., Bagheri, A., Al‐Ali, H., Powell, S. K., Brown, P. T., Volmar, C. H., Foster, T. C., Zeier, Z., & Wahlestedt, C. (2019). Enhancement of BDNF expression and memory by HDAC inhibition requires BET bromodomain reader proteins. Journal of Neuroscience, 39(4), 612–626.
Schmid, C., Albertson, C., & Slikker, W., Jr. (1997). Fluoro‐Jade: A novel fluorochrome for the sensitive and reliable histochemical localization of neuronal degeneration. Brain Research, 751(1), 37–46.
Schweizer, S., Meisel, A., & Marschenz, S. (2013). Epigenetic mechanisms in cerebral ischemia. Journal of Cerebral Blood Flow and Metabolism, 33(9), 1335–1346.
Sheikh, B. N. (2014). Crafting the brain—Role of histone acetyltransferases in neurodevelopment and disease. Cell Tissue, 356(3), 553–573.
Stanzione, R., Cotugno, M., Bianchi, F., Marchitti, S., Forte, M., Volpe, M., & Rubattu, S. (2020). Pathogenesis of ischemic stroke: Role of epigenetic mechanisms. Genes, 11(1), 89.
Stephanou, A., & Latchman, D. S. (2011). Transcriptional modulation of heat‐shock protein gene expression. Biochemistry Research International, 2011, 238601–238608.
Sun, J., Ming, G. L., & Song, H. (2011). Epigenetic regulation of neurogenesis in the adult mammalian brain. European Journal of Neuroscience, 33(6), 1087–1093.
Suo, H., Wang, P., Tong, J., Cai, L., Liu, J., Huang, D., Huang, L., Wang, Z., Huang, Y., Xu, J., Ma, Y., Yu, M., Fei, J., & Huang, F. (2015). NRSF is an essential mediator for the neuroprotection of trichostatin A in the MPTP mouse model of Parkinson’s disease. Neuropharmacology, 99, 67–78.
Tapias, A., & Wang, Z. Q. (2017). Lysine acetylation and deacetylation in brain development and neuropathies. Genomics, Proteomics & Bioinformatics/Beijing Genomics Institute, 15(1), 19–36.
Tian, F., Marini, A. M., & Lipsky, R. H. (2010). Effects of histone deacetylase inhibitor trichostatin A on epigenetic changes and transcriptional activation of Bdnfpromoter 1 by rat hippocampal neurons. Annals of the New York Academy of Sciences, 99, 186–193. Tsankova, N. M., Kumar, A., & Nestler, E. J. (2004). Histone modifications at gene promoter regions in rat hippocampus after acute and chronic electroconvulsive seizures. Journal of Neuroscience, 24(24), 5603–5610.
Wang, Z., Havasi, A., Gall, J., Bonegio, R., Li, Z., Mao, H., Schwartz, J. H., & Borkan, S. C. (2010). GSK3beta promotes apoptosis after renal ischemic injury. Journal of the American Society of Nephrology, 21(2), 284–294.
Yamawaki, Y., Fuchikami, M., Morinobu, S., Segawa, M., Matsumoto, T., & Yamawaki, S. (2012). Antidepressant‐like effect of sodium butyrate (HDAC inhibitor) and its molecular mechanism of action in the rat hippocampus. World Journal of Biological Psychiatry, 6, 458–467.
Yang, X. J., & Seto, E. (2008). The Rpd3/Hda1 family of lysine deacetylases: From bacteria and yeast to mice and men. Nature Reviews Molecular Cell Biology, 3, 206–218.
Yildirim, F., Ji, S., Kronenberg, G., Barco, A., Olivares, R., Benito, E., Dirnagl, U., Gertz, K., Endres, M., Harms, C., & Meisel, A. (2014). Histone acetylation and CREB binding protein are required for neuronal resistance against ischemic injury. PLOS One, 9(4), e95465.
Zhu, X., Li, Q., Chang, R., Yang, D., Song, Z., Guo, Q., & Huang, C. (2014). Curcumin alleviates neuropathic pain by inhibiting p300/CBP histone acetyltransferase activity‐regulated expression of BDNF and cox‐2 in a rat model. PLOS One, 9(3), e91303.
Ziemke‐Nalecz, M., Jaworska, J., Sypecka, J., & Zalewska, T. (2018). Histone deacetylase inhibitors: A therapeutic key in neurological disorders? Journal of Neuropathology and Experimental Neurology, 77(10), 855–870.